miércoles, 23 de junio de 2010

Se que ya hay muchas blogeras que han hecho amistad y quedan y eso...Sinceramente me muero de la envidia,mis amistades de el blog viven un poco lejos,pero bueno,nunca se sabe!

Miraaaaad que regalito me ha hecho una de estas amigas!Lo peor es que no se como darle las gracias,me gustaria achucharla y dejarla medio sorda gritandole con voz de pito.

Os presento a mi propia kabezona!!^^
En su blog podeis ver muuuchas mas kabezonas. :)

**************************************************************************************
**************************************************************************************




"Estoy buscando en el diccionario el significado de aneurisma para ver si me acaba de dar uno"


- No puedo llegar tarde mi primer día, ¿sabes lo que le pasa a la gente que llega tarde el primer día?
- ¿Que el día es más corto?

-Nos gusta el internet lento, ¿vale? Podemos conectarnos, dar un paseo, bailar, hacer un sandwich... con ADSL no habría baile ni paseo, sólo aburrimiento.





- Me olvidé la caja de herramientas y he venido a buscarla.
- Está ahí. Rory y yo no podemos con ella, sino te la habríamos llevado. Entonces la tenemos ahí y la llamamos Bert y por la noche le decimos 'Buenas noches Bert' y el dice ' Buenas noches chicas'.


- He cambiado los muebles.
- Claro, bien pensado. Y he visto q no has cambiado la televisión.
- Pesa mucho.
- Cierto, vale. Puees me gusta, si, esta bien. Claro q cuando el sofá estaba frente a la tele facilitaba lo de verla, pero así también esta bien, es como... una radio


- ¿Papá?
- Sí ¿quien es?
- Soy Lorelai, ¿alguien más te llama papá?

*Las chicas gilmore.

Mi pequeño gatito ya no es tan pequeño...

75 comentarios:

  1. Chulísimo el dibujo.
    Y bueno eso de quedar con la blogosfera, a mi tb me pilla muy lejos de muchas....
    Genial el vestido fucsia

    besos
    AzaharaJS

    ResponderEliminar
  2. que pasada el dibujo! me encanta! que suerte tienes que te hagan dibujos así. y el vestido que llevas, es una pasada! me gusta! besos!

    ResponderEliminar
  3. Guapa a rabiar!!!
    el dibujo es chulísimo, no había visto la foto en la que se ha inspirado para hacerlo, me encanta!!
    1besooo

    ResponderEliminar
  4. Que regalo más total!!
    Me encantan los gatos, el tuyo es guapisimo

    Moa

    ladygrett.com

    ResponderEliminar
  5. Menuda cabezona más chula!!!
    Que wapa de rosa, me encanta el vestido.
    Un beso!

    ResponderEliminar
  6. que guay el vestido rosa!!me encanta la foto en la que sales agarrandote a la puerta..el dibujo muy gracioso!!besos

    ResponderEliminar
  7. GUUUUUAAAAAAAAAUUUUU!!!!!!!! QUE FOTOS TAN BUENAS!!!
    por cierto... el dibujo está genial ¡¡ qué suerte !! Y... respecto a lo de las amigas bloggueras... es cierto que siempre la gente más guay vive lejos... jooooooo

    PD. me encantan tus diálogos (o textos) que introduces en cada enrada entre las fotos.

    Besitos y felíz noche de San Juan.

    ResponderEliminar
  8. chulisimo el dibujo!! q suerte!! :)
    Me encantan las Chicas Gilmore
    UNBESITO LINDA

    ResponderEliminar
  9. Gracias por pasar por mi blog! me necanta el tuyo, esta super chulo!!

    Besis!

    ResponderEliminar
  10. WOWWW!!! gracias wapa por colgarla!!! :DDDD MUAK MUAK!!!!!!!!!!

    ResponderEliminar
  11. hola wapísima!! ya te echábamos en falta......xulísima tu kbezona ¡se sale!
    si estaría guay una quedada- blogger de vez en cuando^^.
    Si paso por Sevilla te aviso ;P!
    un muaSS enoooooooooorme

    ResponderEliminar
  12. Qué dedicatoria más chula, la cabezona es genial! Las fotos son fantásticas!

    ResponderEliminar
  13. El regalo es guapísimo!!! Enhorabuena.
    Y esos relojes se pueden llevar en cualquier momento, incluso de noche :)

    ResponderEliminar
  14. Me encanta la cabezona, es cuquísima! :D

    ResponderEliminar
  15. que croquis mas guay!!!!! chulissimo!!! un regalo mas bonito!!!. seguro que la que te lo regalo este super contenta vivir lejo para no quedarse sorda por tu culpa!!!
    Tambien lo que me da mucha envidia son tus piernas chiki!!!! que lujo...
    besote
    Stephanie

    ResponderEliminar
  16. Aló
    Que bello esta el dibujo jeje y las fotos muy lindas =D me encantan tus fotos...
    Saludos XOXO♥

    ResponderEliminar
  17. Buaf, mola muchisiimo el dibujo, jaja es genial :)
    A proposito me encanta el vestido rosa, ese color te sienta genial, sabías? Un besote <3

    ResponderEliminar
  18. hoola! me cambio de blog!! http://senoritalunares.blogspot.com/
    besitos

    ResponderEliminar
  19. Yo quiero una cabezona!!!!!

    Un beso nena.

    ResponderEliminar
  20. ¡Pedazo de vestido!
    Fucsia,
    ¿existe un color mejor?
    Me encanta,
    Bss!

    ResponderEliminar
  21. De dónde es esa maravilla de vestido si puede saberse? Estás ESPECTACULAR, muy bueno el blog en general: la combinación citas y diálogos con chispa más moda...igual a diez! Besitossss

    ResponderEliminar
  22. jajaja q vaa!es un trozo de tela de tul!!!y solo esta sujeto con el cinturon.:p
    si te fijas bien esta cutrisimo!lo que pasa es que es muy vistoso.jaja
    un beso!y muchas gracias!

    ResponderEliminar
  23. pues aunque digas que es solo un trozo de tela, te ha quedado estupendo, super sexy jeje

    el dibujo está genial, me enamoró

    estoy igual que tu, ya quisiera reunirme con chicas bloggeras :(

    besitos wapa
    te espero por mi blog

    ResponderEliminar
  24. Que chula!!!

    Y tu vestido me ha encantado ;)

    Besos!

    ResponderEliminar
  25. Gracias por tu comentario!!!

    Q fotos mas graciosas, y el texto ni te cuento!!!

    Besicos

    ResponderEliminar
  26. Yo quiero que me hagan un dibuuuuuuuuuuuu!

    Oyeeee, que bonito tu vestido rosa. De dónde es???
    Kisssssssss

    Leire

    ResponderEliminar
  27. esta super padre la caricatura! que envidia, quiero una igual jajajaj
    tu dress pink esta hermoso y lo luces genial y la mascota minina ni se diga, me caes bien porque te gustan los gatos jajajaj

    besos

    ResponderEliminar
  28. muchas gracias, es un body ;)

    antes me encantaba esa serie! y también me gusta tu cabezona

    xxx

    ResponderEliminar
  29. La kabezona es preciosa! Y tu vestido igual!
    Hace poco hicimos una quedada en Bilbao, fuimos a tomar algo y después a cenar, nos juntamos unos 20! Yo no sabía que eramos tantos! jaj
    Un besito

    ResponderEliminar
  30. alaaaaaaaaaaa!!!
    la kabezona me ha encantado!!!es chulísima!!!
    que bonitaaaaaaaa!!!!!!

    las fotos geniales con el vestido fucsia!
    muak
    R*

    ResponderEliminar
  31. Me alegra que te gusten mis fotos y mis pantalones! jaja
    el dibujo es una pasada! que envidia!
    muy bonito tu vestido!
    Muaah linda

    ResponderEliminar
  32. Está genial tanto el dibujo como el vestido - tela de tul jajaja
    Un besito! Gracias por pasarte.

    M♥

    ResponderEliminar
  33. Te pasa como a mi, todas vivis mu lejos :(
    me encanta el regalito que te ha hecho kabezona, está genial.
    Por cierto guapisima que te veo =)

    ResponderEliminar
  34. que dibujo tan bonito me encanta¡¡¡¡¡¡
    gracias por pasarte por mi blog
    un beso
    al.

    ResponderEliminar
  35. Me encantan tus fotos & tu gatooo (L)
    Las frases son sencillamente geniales :D Amo a las chicas Gilmore (:

    xoxo

    ResponderEliminar
  36. Salvaje y sexy! Me encanta!

    Por cierto, dibujas de maravilla!

    Muuuas!

    ResponderEliminar
  37. que chula la kabezona!!:D las fotos son geniales y las frases muy graciosas jajajajaj! besos:)

    ResponderEliminar
  38. como mola el dibujo!!!!!!
    y que impresionante en las fotos
    besito

    ResponderEliminar
  39. que guapaa! joder el dibujo es chulisimo!
    y el vestido de tul rosa? es un vestido o lo has improvisado?qee original.. me soprendes!

    QUEDADA BLOGUERA EN SEVILLA?? xDDD

    ResponderEliminar
  40. Qué bonito el dibujo es precioso, y tu gato muy guapo.Se nota que me encantan los gatos jeeje

    ResponderEliminar
  41. que pasada!! yo tambien quiero una cabezona jaja
    la verdad que me encanta la foto como el dibujo :D

    un besazo!

    ResponderEliminar
  42. ¡Qué chulas las fotos con el rollito salvaje!
    Por cierto, voy a raptar a tu pequeño gran gatito... que lo sepas.

    ResponderEliminar
  43. muchas gracias por comentaar!
    menudas fotos que tienes tu tambien!
    el vestido es preciosoo!
    un besooo=)

    ResponderEliminar
  44. Ala! Me encantan tus fotos, el vestido y el gato, que mono! Yo también tengo una gata :)
    Que bonito el dibujo!
    Te sigo ;)

    ResponderEliminar
  45. Muchas gracias por el comentario! Me hago seguidora!!!! :)
    me encanta el dibujo!! es precioso!! me pasaré por su blog para conocer más de sus creaciones

    Besos :)

    ResponderEliminar
  46. Que fotos más increíbles!!!!
    El look es genial, me ha encantado.
    Bssss

    ResponderEliminar
  47. jooooooo q suerte! me encanta el dibu!

    ResponderEliminar
  48. q idealel dibujno y tu estas WOWWW. Si las quedadas de bloggers a mí tb me dan mucha envidia, este jueves igual coincido con algunas de mi ciudad así q espero pasarlo genial. un kisss

    ResponderEliminar
  49. me encanta el vestido fuccsia!! muy bueno el blog

    ResponderEliminar
  50. La cabezona monisima, ya puedes estar más que contentaaaaaaa!

    ResponderEliminar
  51. nos encanta tu bloggg!
    pasate, besiñooooss :)

    ResponderEliminar
  52. La cabezona es preciosa, para enmarcarla y darle un lugar privilegiado.

    besos

    ResponderEliminar
  53. como puedes tener un blog tan divertido?? es ideall y tu vestido rosa... me he enamorado vaya! jij
    besitos desde http://sweetsyte.blogspot.com/

    ResponderEliminar
  54. ahahaha I love those quotes, especially the one about the TV
    and I love your pink dress, that drawing is so so pretty too
    you have a nice blog, by the way
    hope you're having a wonderful week

    Marley

    ResponderEliminar
  55. Gracias por pasarte :) Que bonita es la cabezona, mi cabecera tambien me la han regalado ^^ Me gusta el blog, te sigo, un beso (L)

    ResponderEliminar
  56. Tus zapatos nunca decepcionan ;) jaja
    Un beso!

    ResponderEliminar
  57. los muñecos esos los hace mi prima :)

    ResponderEliminar
  58. oyee!Pero tu no eras de Sevilla?? Pues cuando quieras quedamos cabezona!!jaja que mona es!Ahora mismo me meto en su blog. Por cierto, dime tu correo que te quiero contar una cosilla!besitos

    www.meencantamiropa.blogspot.com

    ResponderEliminar
  59. Me encanta la foto y la kabezona también.. yo quiero una!!!!!

    ResponderEliminar
  60. ¿¿¿Pero quieres actualizar, que no dejan de llegarme seguidoras por culpa del dibujo!!!??? xDDDD

    ResponderEliminar
  61. Gracias!! Tu eres muy bonita! Ok now I've run out of spanish comments (I hope that was correct? ;)). Thank you for your lovely comment! I love your style and the photo that a picture was drawn of is amazing! You cat is so cute! <3


    http://skiepies.blogspot.com/

    ResponderEliminar
  62. And am I right that your blog name is four eyes? Very cute, :) I love it. <3

    http://skiepies.blogspot.com/

    ResponderEliminar
  63. Jo, juraría que te contesté :(


    siiiiiiiii claro que es karla!!! :D edité la entrada diciéndooslo ^^

    ResponderEliminar
  64. Muchas muchas gracias chica simpatiquisima :)
    muy graciosa tu kabezona ^^

    ResponderEliminar
  65. la ilustración es genial como tu!!!besos guapa

    ResponderEliminar
  66. ¡Me encanta este vestido! Es precioso.

    Un besazo guapísima.

    ResponderEliminar
  67. sin palabras sobre el vestido fucsia, te queda genial, el look entero es genial. Y aunque esten lejos las amigas blogosferas no hay nada como sentir que te apoyan en lo que haces en la distancia :) me encanta la foto de la que han echo el dibujo.
    un besazo guapisima!
    xxxxxx
    www.emavecigrek.blogspot.com

    ResponderEliminar
  68. oh muchas gracias, estomos encantadisimos con la peque y aunque es un cambio de vida importante, es lo mas bonito del Mundo.

    el dibujo es una pasada.
    y tus sesiones de fotos tmb.
    Muackkk

    ResponderEliminar
  69. Love! Gato enorme!!!! Es amor. ♥
    Quiero veros, cervecitas en el mini no estaría mal...
    Maw llega el sábado, y llega para quedarse! No sé si estarás al día. Hablamos vía Facebook para quedar antes de que me vaya de vacaciones!

    Muá!

    ResponderEliminar
  70. ¡Esta entrada me encanta!
    1ºPor tu foto y la réplica hecha kabezona
    2ºPor tu estilazo de rosa con los candeleros
    3ºY por lo que he adorado tu post: ¡las frases de Gilmore Girls!!!

    Un beso y gracias por haberte pasado por mi blog
    http://milaco87.blogspot.com/

    ResponderEliminar
  71. Qué guapa!
    Besitoos!
    diariodesilvialzar.blogspot.com

    ResponderEliminar